Recent Problems in Evolution - 2001

Table of Contents

Little Sequence Variation Among Ancient Anatomically Modern Humans

Previous studies have shown that there are large difference in The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA between modern humans and Neanderthals. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first study to examine the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of ancient anatomically modern humans was published in 2001, examining the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of 10 ancient Australians. A summary of the HVR-1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of these individuals (compared with the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, modern Aboriginal A common variation in the sequence of DNA among individuals of a species or race.polymorphism, Neanderthals, and chimpanzees) can be found in table , below. The first thing that one notices is that the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variation of ancient humans compared to modern humans is at most 10 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs. LM3, dated at 62,000 years old, varied the most from the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence sharing similarity to a portion of One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 11 in modern humans (thought to have been inserted into the human genome from the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA). The authors concluded that the "loss" of the ancient Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNAvariation seen in LM3 could explain how Neanderthals do not share Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA with modern humans. Although it is certainly possible that part of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA of LM3 was "lost." In fact, of the ten The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences between LM3 and the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, five of those bases correspond to A common variation in the sequence of DNA among individuals of a species or race.polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 60,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals.

Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sequence Variation of Ancient, Anatomically Modern Humans
Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample
(HVR-1)
Age
(ka)
Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817
Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 62 ....................T.G...........CT.T....T..T......TC....G
LM4 <10 .................T...........G................C............
LM15 0.2 ....................T........................T.......C....G
LM55 <10 ...........G.......................T.......................
KS1 10 .C............T.....T.........................CG..T........
KS7 8 ..............T.....T..................T...........C.......
KS8 8-15 ....................T.G..............TG.......C............
KS9 9 .C..................T..............T............C.........G
KS13 8-15 .C............T.....T....C.G.................TC............
KS16 9-15 ....................T...................T.............C..C.
* Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA HVR-1

Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542 .

back

Modern humans hands down winners over Neanderthals

Another critical anatomical difference has been found between Neanderthals and contemporary ancient humans. Wesley Niewoehner, an anthropologist at the University of New Mexico in Albuquerque has built 3D digital maps of the surfaces of the metacarpals, the bones that make up the palm of the hand, from Neanderthals and ancient humans. The shapes of the ends of the metacarpals reflect the kind of grip these creatures had. Niewhoehner's maps suggest that the smaller, slimmer hands of early modern humans were better suited to oblique grips - used when holding a complex tool with a handle, such as a hammer. Neanderthals, by comparison, were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a Neanderthal), but not very dexterous. The anatomy of the Neanderthals would have prevented them from engaging in fine motor skills, such as carving and painting. The more sophisticated use of tools by early modern humans would have given them a great survival advantage over Neanderthals, possibly leading to the extinction of the Neanderthals.

Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature .
Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences .

back

Another blow to multiregional evolutionary theory

The multiregional evolutionary theory claims that humans are descended from multiple hominid forms (Neanderthals, Homo erectus, etc.). Recently, proponents of this theory have claimed that fossils show that an archaic Homo erectus from Java shared key features with living Asians and early modern humans in Australia. Their conclusion was that Asian H. erectus passed on some of its Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA to modern Australians and Asians (Science, 12 January 2001, p. 293 ). A recent genetic analysis of Asians, however, explodes this theory. The study, examining more than 1000 Asian men, determined that all of these men came from one source, between 35,000 and 89,000 years ago. The study is so convincing that some multiregional evolutionists have now dropped this theory. At the annual meeting of physical anthropologists in Kansas City, Missouri, one self-described "dedicated multiregionalist," Vince Sarich of the University of California, Berkeley, admitted: 

"I have undergone a conversion--a sort of epiphany. There are no old Y chromosome lineages [in living humans]. There are no old Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA lineages. Period. It was a total replacement."

Gibbons, A. 2001. Modern Men Trace Ancestry to African Migrants. Science 292: 1051-1052.
Yuehai Ke, et al. 2001. African Origin of Modern Humans in East Asia: A Tale of 12,000  One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosomes. Science 292: 1151-1153.

back

Fully formed crustacean found from the early Cambrian

In a huge setback for evolutionists, scientists have discovered a true crustacean in early Cambrian strata from Shropshire, England. In a recent issue of Science, Drs. Siveter, Williams, and Waloszek. announced the discovery of a fossil phosphatocopid ostracod, which is preserved extraordinarily well, including all its delicate limbs cast in calcium phosphate, clearly allowing it to be classified as a crustacean. Very few fossils of this great antiquity reveal so much detail or can be interpreted with such certainty. Although the discovery is clearly at odds with evolutionary theory, an analysis in the same issue by Dr. Richard Fortey comes to the remarkable conclusion that this discovery explodes the Cambrian explosion. Dr. Fortey believes that this discovery will foreshadow the discovery of precursor organisms from the pre-Cambrian. Of course, the fact that this has not happened yet does not hinder the evolutionists from wildly speculating that the Cambrian explosion will be overturned. Dr. Fortey does make a rather telling admission at the end of the article (followed by the usual party line):

"Even if evidence for an earlier origin is discovered, it remains a challenge to explain why so many animals should have increased in size and acquired shells within so short a time at the base of the Cambrian. At the moment, there are almost as many explanations as there are animals caught in this belated "explosion." But it is more than likely that the evolutionary fuse was lit long before the Cambrian."

D. J. Siveter, M. Williams, and D. Waloszek. 2001. Science 293: 479 .
Fortey, R. 2001. The Cambrian Explosion Exploded? Science 293: 438-439.

back

Back to Recent Problems in Evolution

http://www.godandscience.org//evolution/evol2001.html
Last updated January 2, 2002