Ancient Anatomically Modern Human Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA

Mean Difference in Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sequence
Individual Modern Europeans Neandertals
Mean Min. Max. s.d. Mean Min. Max. s.d.
Cro-Magnon1 2.3 0 11 1.8 24.5 23 28 2.4
Cro-Magnon2 3.2 0 10 1.7 23.5 22 27 2.4
Modern Europeans 4.4 0 18 2.3      
Next Last Origin of Mankind and the Races Home
First | Previous | Next | Last |        | Index | Home

Slide 59 of 109


Knowing the variation of The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences between modern humans and Neanderthals is important in determining if Neanderthals contributed to the human The functional and physical unit of heredity passed from parent to offspring. Genes are pieces of DNA, and most genes contain the information for making a specific protein.gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of 10 ancient Australians (1). A summary of the HVR-1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of these individuals (compared with the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, modern Aboriginal A common variation in the sequence of DNA among individuals of a species or race.polymorphism, Neanderthals, and chimpanzees) can be found in the Table, below. The first thing that one notices is that the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variation of ancient humans compared to modern humans is at most 10 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs (in LM3, the most ancient specimen), which is nearly equal to the average variation among modern humans population groups, which is 8 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs. LM3, dated at 40,000 years old (redated from the original estimate of 62,000 years old, 2), varied the most from the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced to date), it is apparent that the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome was already nearly "modern" before Neanderthals died out. Of the ten The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences between LM3 and the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, five of those bases correspond to A common variation in the sequence of DNA among individuals of a species or race.polymorphisms found in modern Aboriginal people, leaving only a five base difference - certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals.

A second study examined the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of two Cro-Magnon specimens dated to 23,000 and 25,000 years old (3). One specimen (Paglicci-25) had no The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences from the modern reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, and the other (Paglicci-12) only one Replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.substitution (see table below). It is remarkable that so little change in the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence had occurred over the last 23,000 years of human "evolution."

Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sequence Variation of Ancient, Anatomically Modern Humans (1)
Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample
(HVR-1)
Age
(ka)

Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817

Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 40 GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 40# ....................T.G...........CT.T....T..T......TC....G
Paglicci-25 23 ...........................................................
Paglicci-12 25 ....................T......................................
* Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA HVR-1
#redated from the original 62 ka estimate.

References Top of page

  1. Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542

  2. Bowler, J. M., Johnston, H., Olley, J. M., Prescott, J. R., Roberts, R. G., Shawcross, W., and Spooner, N. A. 2003. New ages for human occupation and climatic change at Lake Mungo, Australia. Nature 421: 837-840.

  3. Caramelli, D., C. Lalueza-Fox, C. Vernesi, M. Lari, A. Casoli, F. Mallegnii, B. Chiarelli, I. Dupanloup, J. Bertranpetit, G. Barbujani, and G. Bertorelle. 2003. Evidence for a genetic discontinuity between Neandertals and 24,000-year-old anatomically modern Europeans. Proceedings of the National Academy of Science USA 100: 6593-6597.

http://www.godandscience.org//evolution/sld059.html
Last Modified June 21, 2006